pGL3-Basic
DB00012;pGL3.0-Basic
100μg liquid plasmid(Instantly):$57
DB00012;pGL3.0-Basic
100μg liquid plasmid(Instantly):$57
| name | pGL3-Basic | another name | apGL3-Basic |
| Insert Size (bp) | Plasmid host | Mammary cell | |
| Plasmid uses | Promoter detection | Fragment type | Promoter |
| Fragment species | Empty vector | Prokaryotic resistance | Amp |
| Selective marker | Fluorescent labeling | Fluc | |
| Promoter | Replicon | pUC | |
| Competence | DH5a | Growth Temperature | 37°C |
| Vector backbone | 5′ sequencing primer | RVP3:CTAGCAAAATAGGCTGTCCC | |
| 3′ sequencing primer | GLP2:CTTTATGTTTTTGGCGTCTTCC | Copy number | high |
| Induction methodanother name |
1. All products on this platform are only for scientific research and cannot be used for clinical trials;
2. The small package of plasmids is sold at the price of the template, which only guarantees the correct sequencing of the gene part, and does not guarantee the experimental effect such as the expression of the plasmid;
3. Some plasmids have not been completely sequenced even if they are produced by the company, and if the sequence sequencing of key parts is correct, it is also considered to be the correct plasmid;
4. The after-sales period of small package plasmid products is 3 months from the date you receive the product.
5. Plasmid construction is charged at cost, all plasmids will be shared with other experimenters, please inform and pay confidential fees in advance for confidential plasmids;
6. Because scientific research is an activity to explore the unknown, there is great uncertainty, so Biogege does not bear additional joint and several liability under any circumstances;
7. Publication [Chinese papers] please mark: product name (product item number) provided by Biogege;
8. Please mark Product Name (Product Item Number) was obtained from Biogege,China.
Instructions
Plasmid dry powder (stored at minus 20 degrees, shelf life 90 days, transportation at room temperature)
1. After receiving the dry powder plasmid, please centrifuge at 5000rpm for 1min, and then add 20μl of sterile water to dissolve the plasmid;
2. Thaw the corresponding competent on an ice box, take 2 μl of plasmid and add it to 100 μl of competent for 30min;
3. 42 degrees heat shock for 60s, ice bath for 2min, add 900 of antibiotic-free LB medium, and culture at 180rpm shaking for 45min;
4. Centrifuge at 6000rpm for 3min, leave 100μl of supernatant to resuspend, and then coat it on the corresponding resistant LB plate;
5.After inverting overnight, if there are too many colonies, the plasmid will be diluted for transformation, and if there are no colonies, 10ul plasmid will be taken for transformation;
6. Pick single colonies into the corresponding resistant LB liquid medium overnight shaking culture, and extract the plasmid as needed.
Liquid plasmid (minus 20 degrees storage, shelf life 90 days, ice pack transportation).
1. After receiving the liquid plasmid, please shake the preservation tube so that the liquid plasmid does not adsorb on the tube wall;
2.Take an appropriate amount of plasmid according to the experimental needs, and store the rest in a minus 20 degree freezer.
Glycerol strains (stored at minus 80 degrees, shelf life of 90 days, ice pack transportation).
1. After receiving the glycerol strain, please shake the preservation tube so that the bacterial solution does not adsorb on the tube wall;
2. Use the inoculation loop to mark the line in four areas on the solid plate, and add the corresponding resistance if there is resistance;
3. Inverted culture in constant temperature incubator for 12~16h;
4. Be sure to pick a single colony and inoculate it in the liquid medium, and add the corresponding resistance if there is resistance;
5. Shake the shaker and culture overnight, and culture the strains according to the needs of the experiment.
ggtaccgagc tcttacgcgt gctagcccgg gctcgagatc tgcgatctaa gtaagcttgg cattccggta ctgttggtaa agccaccatg gaagacgcca aaaacataaa gaaaggcccg gcgccattct atccgctgga agatggaacc gctggagagc aactgcataa ggctatgaag agatacgccc tggttcctgg aacaattgct tttacagatg cacatatcga ggtggacatc acttacgctg agtacttcga aatgtccgtt cggttggcag aagctatgaa acgatatggg ctgaatacaa atcacagaat cgtcgtatgc agtgaaaact ctcttcaatt ctttatgccg gtgttgggcg cgttatttat cggagttgca gttgcgcccg cgaacgacat ttataatgaa cgtgaattgc tcaacagtat gggcatttcg cagcctaccg tggtgttcgt ttccaaaaag gggttgcaaa aaattttgaa cgtgcaaaaa aagctcccaa tcatccaaaa aattattatc atggattcta aaacggatta ccagggattt cagtcgatgt acacgttcgt cacatctcat ctacctcccg gttttaatga atacgatttt gtgccagagt ccttcgatag ggacaagaca attgcactga tcatgaactc ctctggatct actggtctgc ctaaaggtgt cgctctgcct catagaactg cctgcgtgag attctcgcat gccagagatc ctatttttgg caatcaaatc attccggata ctgcgatttt aagtgttgtt ccattccatc acggttttgg aatgtttact acactcggat atttgatatg tggatttcga gtcgtcttaa tgtatagatt tgaagaagag ctgtttctga ggagccttca ggattacaag attcaaagtg cgctgctggt gccaacccta ttctccttct tcgccaaaag cactctgatt gacaaatacg atttatctaa tttacacgaa attgcttctg gtggcgctcc cctctctaag gaagtcgggg aagcggttgc caagaggttc catctgccag gtatcaggca aggatatggg ctcactgaga ctacatcagc tattctgatt acacccgagg gggatgataa accgggcgcg gtcggtaaag ttgttccatt ttttgaagcg aaggttgtgg atctggatac cgggaaaacg ctgggcgtta atcaaagagg cgaactgtgt gtgagaggtc ctatgattat gtccggttat gtaaacaatc cggaagcgac caacgccttg attgacaagg atggatggct acattctgga gacatagctt actgggacga agacgaacac ttcttcatcg ttgaccgcct gaagtctctg attaagtaca aaggctatca ggtggctccc gctgaattgg aatccatctt gctccaacac cccaacatct tcgacgcagg tgtcgcaggt cttcccgacg atgacgccgg tgaacttccc gccgccgttg ttgttttgga gcacggaaag acgatgacgg aaaaagagat cgtggattac gtcgccagtc aagtaacaac cgcgaaaaag ttgcgcggag gagttgtgtt tgtggacgaa gtaccgaaag gtcttaccgg aaaactcgac gcaagaaaaa tcagagagat cctcataaag gccaagaagg gcggaaagat cgccgtgtaa ttctagagtc ggggcggccg gccgcttcga gcagacatga taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt tttaaagcaa gtaaaacctc tacaaatgtg gtaaaatcga taaggatccg tcgaccgatg cccttgagag ccttcaaccc agtcagctcc ttccggtggg cgcggggcat gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc ggcagcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttccc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagcc caagctacca tgataagtaa gtaatattaa ggtacgggag gtacttggag cggccgcaat aaaatatctt tattttcatt acatctgtgt gttggttttt tgtgtgaatc gatagtacta acatacgctc tccatcaaaa caaaacgaaa caaaacaaac tagcaaaata ggctgtcccc agtgcaagtg caggtgccag aacatttctc tatcgata