pET-32c

$99.00
In stock
SKU
PL77063

pET32c

100μg liquid plasmid(Instantly):$134

 name  pET-32c another name apET-32c
Insert Size (bp) Plasmid host Escherichia coli
Plasmid uses Protein expression Fragment type ORF
Fragment species  Empty vector Prokaryotic resistance Amp
Selective marker Fluorescent labeling
Promoter T7 Replicon pBR322
Competence DH5a Growth Temperature 37°C
Vector backbone 5′ sequencing primer T7:TAATACGACTCACTATAGGG
3′ sequencing primer T7ter:TGCTAGTTATTGCTCAGCGG Copy number low
Induction methodanother name    

 

1. All products on this platform are only for scientific research and cannot be used for clinical trials;
2. The small package of plasmids is sold at the price of the template, which only guarantees the correct sequencing of the gene part, and does not guarantee the experimental effect such as the expression of the plasmid;
3. Some plasmids have not been completely sequenced even if they are produced by the company, and if the sequence sequencing of key parts is correct, it is also considered to be the correct plasmid;
4. The after-sales period of small package plasmid products is 3 months from the date you receive the product.
5. Plasmid construction is charged at cost, all plasmids will be shared with other experimenters, please inform and pay confidential fees in advance for confidential plasmids;
6. Because scientific research is an activity to explore the unknown, there is great uncertainty, so Biogege does not bear additional joint and several liability under any circumstances;
7. Publication [Chinese papers] please mark: product name (product item number) provided by Biogege;
8. Please mark Product Name (Product Item Number) was obtained from Biogege,China.

 

 

Instructions

Plasmid dry powder (stored at minus 20 degrees, shelf life 90 days, transportation at room temperature)
1. After receiving the dry powder plasmid, please centrifuge at 5000rpm for 1min, and then add 20μl of sterile water to dissolve the plasmid;
2. Thaw the corresponding competent on an ice box, take 2 μl of plasmid and add it to 100 μl of competent for 30min;
3. 42 degrees heat shock for 60s, ice bath for 2min, add 900 of antibiotic-free LB medium, and culture at 180rpm shaking for 45min;
4. Centrifuge at 6000rpm for 3min, leave 100μl of supernatant to resuspend, and then coat it on the corresponding resistant LB plate;
5.After inverting overnight, if there are too many colonies, the plasmid will be diluted for transformation, and if there are no colonies, 10ul plasmid will be taken for transformation;
6. Pick single colonies into the corresponding resistant LB liquid medium overnight shaking culture, and extract the plasmid as needed.

Liquid plasmid (minus 20 degrees storage, shelf life 90 days, ice pack transportation).
1. After receiving the liquid plasmid, please shake the preservation tube so that the liquid plasmid does not adsorb on the tube wall;
2.Take an appropriate amount of plasmid according to the experimental needs, and store the rest in a minus 20 degree freezer.

Glycerol strains (stored at minus 80 degrees, shelf life of 90 days, ice pack transportation).
1. After receiving the glycerol strain, please shake the preservation tube so that the bacterial solution does not adsorb on the tube wall;
2. Use the inoculation loop to mark the line in four areas on the solid plate, and add the corresponding resistance if there is resistance;
3. Inverted culture in constant temperature incubator for 12~16h;
4. Be sure to pick a single colony and inoculate it in the liquid medium, and add the corresponding resistance if there is resistance;
5. Shake the shaker and culture overnight, and culture the strains according to the needs of the experiment.

ACATCTACGT ATTAGTCATC GCTATTACCA TGG

Reviews

Write Your Own Review
You're reviewing:pET-32c
Your Rating
Copyright © 2025 Biogege, Inc. All rights reserved.